2019-03-25 13:12:092025-05-14 20:00:20
locus
BSU01750
BSU_01750
outlinks
bsu
BSU01750
BSU_01750
The protein
Catalyzed reaction/ biological activity
synthesis of c-di-AMP from two molecules of ATP [Pubmed|23192352]
synthesis of c-di-AMP from two molecules of ATP [Pubmed|23192352]
2 ATP --> c-di-AMP + 2 diphosphate (according to UniProt)
The protein
[SW|Domains]
contains a [SW|DAC domain] involved in the synthesis of c-di-AMP [Pubmed|21566650]
contains a [SW|DAC domain] involved in the synthesis of c-di-AMP [Pubmed|21566650]
[SW|DAC domain] (aa 82-242) (according to UniProt)
The protein
[SW|Cofactors]
Mn2+ [pubmed|25605729]
Mn2+ [pubmed|31118276,25605729]
The protein
Effectors of protein activity
the interaction with [[protein|CdaR]] controls the diadenylate cyclase activity of [[protein|CdaA]] [Pubmed|23192352]
the interaction with [[protein|CdaR]] inhibits the diadenylate cyclase activity of [[protein|CdaA]] (shown in S. aureus) [pubmed|30668586]
the interaction with [[protein|CdaR]] controls the diadenylate cyclase activity of [[protein|CdaA]] [Pubmed|23192352]
the interaction with [[protein|CdaR]] inhibits the diadenylate cyclase activity of [[protein|CdaA]] (shown in S. aureus) [pubmed|30668586]
the interaction with [[protein|GlmM]] inhibits the diadenylate cyclase activity of [[protein|CdaA]] under conditions of osmotic stress (shown in L. monocytogenes) [pubmed|32250026]
The protein
Structure
[PDB|4RV7] (the [SW|DAC domain] and C-terminal domain of CdaA from ''Listeria monocytogenes'' (aa 101 - 273), 65% identity) [Pubmed|25605729]
[PDB|6HUW]
[PDB|4RV7] (the [SW|DAC domain] and C-terminal domain of CdaA from ''Listeria monocytogenes'' (aa 101 - 273), 65% identity) [Pubmed|25605729]
[PDB|6HVL] (the [SW|DAC domain] and C-terminal domain of CdaA from ''Listeria monocytogenes'' (aa 101 - 273) in complex with c-di-AMP, 65% identity) [Pubmed|31118276]
Biological materials
Mutant
GP94 (D''[[gene|cdaA]]''::''spc''), available in [SW|Jörg Stülke]'s lab [pubmed|28420751]
GP997 (''[[gene|cdaA]]''::''cat''), available in [SW|Jörg Stülke]'s lab [pubmed|23192352]
GP2790 Δ[[gene|cdaA]]::aphA3, available in [SW|Jörg Stülke]'s lab
GP985 (''[[gene|cdaA]]''-''[[gene|cdaR]]''::''cat''), available in [SW|Jörg Stülke]'s lab
GP2222 ([[gene|cdaA]]::cat [[gene|cdaS]]::ermC ''[[gene|disA]]''::''tet''), available in [SW|Jörg Stülke]'s lab, the mutant is only viable on minimal medium at low potassium concentration [pubmed|28420751]
BKE01750 (Δ[[gene|cdaA]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCTCGTCCTCCAAGA, downstream forward: _UP4_CGCTGGTATTGGAGGGGCAA
BKK01750 (Δ[[gene|cdaA]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCTCGTCCTCCAAGA, downstream forward: _UP4_CGCTGGTATTGGAGGGGCAA
GP94 Δ[[gene|cdaA]]::spec, available in [SW|Jörg Stülke]'s lab [pubmed|28420751]
GP997 Δ[[gene|cdaA]]::cat, available in [SW|Jörg Stülke]'s lab [pubmed|23192352]
GP2790 Δ[[gene|cdaA]]::aphA3, available in [SW|Jörg Stülke]'s lab
GP985 (''[[gene|cdaA]]''-''[[gene|cdaR]]''::''cat''), available in [SW|Jörg Stülke]'s lab
GP2222 ([[gene|cdaA]]::cat [[gene|cdaS]]::ermC ''[[gene|disA]]''::''tet''), available in [SW|Jörg Stülke]'s lab, the mutant is only viable on minimal medium at low potassium concentration [pubmed|28420751]
BKE01750 (Δ[[gene|cdaA]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCTCGTCCTCCAAGA, downstream forward: _UP4_CGCTGGTATTGGAGGGGCAA
BKK01750 (Δ[[gene|cdaA]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCTCGTCCTCCAAGA, downstream forward: _UP4_CGCTGGTATTGGAGGGGCAA
References
Reviews
References
Original publications
The protein
Protein family
adenylate cyclase family (with [[protein|CdaS]], according to UniProt)
labs
[SW|Jörg Stülke], University of Göttingen, Germany [http://genmibio.uni-goettingen.de Homepage]