SubtiBank SubtiBank
Version comparison:

2019-03-25 13:12:092025-05-14 20:00:20

locus

BSU01750

BSU_01750

outlinks

bsu

BSU01750

BSU_01750

The protein

Catalyzed reaction/ biological activity

synthesis of c-di-AMP from two molecules of ATP [Pubmed|23192352]

synthesis of c-di-AMP from two molecules of ATP [Pubmed|23192352]

2 ATP --> c-di-AMP + 2 diphosphate (according to UniProt)

The protein

[SW|Domains]

contains a [SW|DAC domain] involved in the synthesis of c-di-AMP [Pubmed|21566650]

contains a [SW|DAC domain] involved in the synthesis of c-di-AMP [Pubmed|21566650]

[SW|DAC domain] (aa 82-242) (according to UniProt)

The protein

[SW|Cofactors]

Mn2+ [pubmed|25605729]

Mn2+ [pubmed|31118276,25605729]

The protein

Effectors of protein activity

the interaction with [[protein|CdaR]] controls the diadenylate cyclase activity of [[protein|CdaA]] [Pubmed|23192352]

the interaction with [[protein|CdaR]] inhibits the diadenylate cyclase activity of [[protein|CdaA]] (shown in S. aureus) [pubmed|30668586]

the interaction with [[protein|CdaR]] controls the diadenylate cyclase activity of [[protein|CdaA]] [Pubmed|23192352]

the interaction with [[protein|CdaR]] inhibits the diadenylate cyclase activity of [[protein|CdaA]] (shown in S. aureus) [pubmed|30668586]

the interaction with [[protein|GlmM]] inhibits the diadenylate cyclase activity of [[protein|CdaA]] under conditions of osmotic stress (shown in L. monocytogenes) [pubmed|32250026]

The protein

Structure

[PDB|4RV7] (the [SW|DAC domain] and C-terminal domain of CdaA from ''Listeria monocytogenes'' (aa 101 - 273), 65% identity) [Pubmed|25605729]

[PDB|6HUW]

[PDB|4RV7] (the [SW|DAC domain] and C-terminal domain of CdaA from ''Listeria monocytogenes'' (aa 101 - 273), 65% identity) [Pubmed|25605729]

[PDB|6HVL] (the [SW|DAC domain] and C-terminal domain of CdaA from ''Listeria monocytogenes'' (aa 101 - 273) in complex with c-di-AMP, 65% identity) [Pubmed|31118276]

Biological materials

Mutant

GP94 (D''[[gene|cdaA]]''::''spc''), available in [SW|Jörg Stülke]'s lab [pubmed|28420751]

GP997 (''[[gene|cdaA]]''::''cat''), available in [SW|Jörg Stülke]'s lab [pubmed|23192352]

GP2790 Δ[[gene|cdaA]]::aphA3, available in [SW|Jörg Stülke]'s lab

GP985 (''[[gene|cdaA]]''-''[[gene|cdaR]]''::''cat''), available in [SW|Jörg Stülke]'s lab

GP2222 ([[gene|cdaA]]::cat [[gene|cdaS]]::ermC ''[[gene|disA]]''::''tet''), available in [SW|Jörg Stülke]'s lab, the mutant is only viable on minimal medium at low potassium concentration [pubmed|28420751]

BKE01750 (Δ[[gene|cdaA]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCTCGTCCTCCAAGA, downstream forward: _UP4_CGCTGGTATTGGAGGGGCAA

BKK01750 (Δ[[gene|cdaA]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCTCGTCCTCCAAGA, downstream forward: _UP4_CGCTGGTATTGGAGGGGCAA

GP94 Δ[[gene|cdaA]]::spec, available in [SW|Jörg Stülke]'s lab [pubmed|28420751]

GP997 Δ[[gene|cdaA]]::cat, available in [SW|Jörg Stülke]'s lab [pubmed|23192352]

GP2790 Δ[[gene|cdaA]]::aphA3, available in [SW|Jörg Stülke]'s lab

GP985 (''[[gene|cdaA]]''-''[[gene|cdaR]]''::''cat''), available in [SW|Jörg Stülke]'s lab

GP2222 ([[gene|cdaA]]::cat [[gene|cdaS]]::ermC ''[[gene|disA]]''::''tet''), available in [SW|Jörg Stülke]'s lab, the mutant is only viable on minimal medium at low potassium concentration [pubmed|28420751]

BKE01750 (Δ[[gene|cdaA]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCTCGTCCTCCAAGA, downstream forward: _UP4_CGCTGGTATTGGAGGGGCAA

BKK01750 (Δ[[gene|cdaA]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCTCGTCCTCCAAGA, downstream forward: _UP4_CGCTGGTATTGGAGGGGCAA

References

Reviews

18714086, 25869574, 23812326, 30224435

18714086, 25869574, 23812326, 30224435, 32472931, 32603625

References

Original publications

12884008, 21566650, 23192352, 22211522, 25605729, 25616256, 26240071, 26527648, 26585449, 28420751, 30668586

32250026, 12884008, 21566650, 23192352, 22211522, 25605729, 25616256, 26240071, 26527648, 26585449, 28420751, 30668586, 31118276, 32250026

The protein

Protein family

adenylate cyclase family (with [[protein|CdaS]], according to UniProt)

labs

[SW|Jörg Stülke], University of Göttingen, Germany [http://genmibio.uni-goettingen.de Homepage]